LeetCode Solution - Problem Repeated DNA Sequences

• The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'. 
• For example, "ACGAATTCCG" is a DNA sequence.
• When studying DNA, it is useful to identify repeated sequences within the DNA.
• Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

Example 1:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC","CCCCCAAAAA"]

LeetCode Solution - Problem Longest Common Prefix

• Write a function to find the longest common prefix string amongst an array of strings.
• If there is no common prefix, return an empty string "".

Example 1:

Input: strs = ["flower","flow","flight"]
Output: "fl"

LeetCode Solution - Problem Reverse String

• Write a function that reverses a string. The input string is given as an array of characters s.
• You must do this by modifying the input array in-place with O(1) extra memory.

Example 1:

Input: s = ["h","e","l","l","o"]
Output: ["o","l","l","e","h"]

LeetCode Solution - Problem Pow(x, n)

• Implement pow(x, n), which calculates x raised to the power n (i.e., x^n).

Example 1:

Input: x = 2.00000, n = 10
Output: 1024.00000

LeetCode Solution - Problem Factorial Trailing Zeroes

• Given an integer n, return the number of trailing zeroes in n!.
• Note that n! = n * (n - 1) * (n - 2) * ... * 3 * 2 * 1.

Example 1:

Input: n = 3
Output: 0
Explanation: 3! = 6, no trailing zero.

LeetCode Solution - Problem Palindrome Number

• Given an integer x, return true if x is a palindrome, and false otherwise. 

Example 1:

Input: x = 121
Output: true
Explanation: 121 reads as 121 from left to right and from right to left.

LeetCode Solution - Problem Reverse Integer

• Given a signed 32-bit integer x, return x with its digits reversed. If reversing x causes the value to go outside the signed 32-bit integer range [-231, 231 - 1], then return 0.
• Assume the environment does not allow you to store 64-bit integers (signed or unsigned).

Example 1:

Input: x = 123
Output: 321

LeetCode Solution - Problem Single Number

• Given a non-empty array of integers nums, every element appears twice except for one. Find that single one.
• You must implement a solution with a linear runtime complexity and use only constant extra space.

Example 1:

Input: nums = [2,2,1]
Output: 1